Ethics statement
The experimental work reported in this manuscript complies with all relevant ethics regulations. The study protocol was approved by the Comité de Etica y Bienestar Animal, Instituto de Salud Carlos III (CBA 09_2015_v2) and the Comunidad Autónoma de Madrid (ES280790000186).
Cells
HEK293 cells were obtained from the ATCC (CRL-1573.3); 266-6 cells were obtained from Dr. I. Rooman (VUB, Brussels, Belgium) who obtained them from ATCC (CRL-2151).
Mice and experimental manipulations
The following mouse strains were used: Nfic-/-19, Ptf1a+/Cre knock-in53, and KrasG12V conditional knock-in8. All crosses were maintained in a predominant C57BL/6 background. Experiments were performed using 8–25-week-old mice of both sexes, as indicated in the text, except for glucose tolerance tests where only males were used. Littermate mice were used as controls. Mice of both genotypes were co-housed. After weaning, mice were fed both with solid pellets and with pellets moistened with water or with a nutritionally fortified gel. The teeth of Nfic-/- mice were clipped using surgical scissors as deemed necessary by the animal room personnel, without intervention of the researchers, to avoid malocclusion. All animal procedures were approved by local and regional ethics committees (Institutional Animal Care and Use Committee and Ethics Committee for Research and Animal Welfare, Instituto de Salud Carlos III) and performed according to the European Union guidelines.
A mild acute pancreatitis was induced by 7 hourly injections of the cholecystokinin analog caerulein (Bachem) at 50 μg/kg. In brief, animals were weighed before the procedure and caerulein was administered intraperitoneally. Mice were killed by cervical dislocation after 1 and 4 h after the last caerulein injection or 24, 48 h, 5 and 14 days after the first caerulein injection. For the glucose tolerance test, male mice were fasted for 16 h and basal glycaemia was measured in tail blood. Mice received a glucose solution (2 g/kg) administered intraperitoneally and glycaemia was measured 15, 30, 60, and 120 min later using an automated glucose monitor (Accu-Chek℗ Aviva). Fasting glucose was considered as baseline (0 h). The number of mice used in each experiment is shown in the legend of each figure. For most experiments, ≥5 mice per group were used. No specific randomization method was used.
Acinar cell isolation
Mice were sacrificed by cervical dislocation. The pancreas was injected with 2.5 mL of chilled collagenase P in HBSS (1.3 mg/mL), dissected, cut in small pieces, and incubated at 37 °C for 30 min (60U shaking speed). The reaction was stopped in a flow hood with 5% FBS/HBSS and the digest was centrifuged at 150 g for 2 min at 4 °C. After removing the supernatant, the pellet was washed twice with 5% FBS/HBSS, resuspended in 5% FBS/HBSS, filtered through a gauze, and rinsed with 5%FBS/HBSS. The resulting suspension was then pipetted through a 100 µm strainer, layered on a 30% FBS/HBSS solution, and centrifuged. The acinar cell fraction was suspended in RPMI supplemented with 10% FBS, Na pyruvate (1 mM) (Sigma-Aldrich), soybean trypsin inhibitor (STI) (Gibco) (0.1 mg/ml), and 1% Pen/Strep, and maintained at 37 °C for 24 h26.
Protein synthesis analysis by flow cytometry
Acinar cells were isolated as described above with minor modifications and maintained at 37 °C for 24 h in RPMI supplemented with 10% FBS, L-glutamine, Na pyruvate (1 mM), STI (0.1 mg/ml), and geneticin (25 mg/mL). Acinar cells were incubated with OP-P (20 mM) for 30 min. Cells were fixed in 4% PFA for 15 min at RT and labeled following a standard Click-It reaction protocol (Invitrogen, C10456). A Gallios Flow Cytometer (Beckman Coulter) was used to measure fluorescence; data were analyzed using FlowJo software. Samples without OP-P were used to determine background signal (control).
Histology, immunofluorescence (IF) and immunohistochemical (IHC) analyses
Pancreata were immediately placed in buffered formalin or 4% paraformaldehyde. Histological processing was performed using standard procedures. To score damage in acute pancreatitis experiments, inflammation-related histological parameters [oedema, inflammatory cell infiltration, vacuolization, and acino-ductal metaplasia (ADM)] were scored blindly by IC and FXR according to the grade of severity (0–3).
IF and IHC analyses were performed using 3 μm sections of formalin-fixed paraffin-embedded tissues, unless otherwise indicated. After deparaffinization and rehydration, antigen retrieval was performed by boiling in citrate buffer pH 6 for 10 min. For IF, sections were incubated for 45 min at room temperature with 3% BSA, 0.1% Triton X-100-PBS and then with the primary antibody overnight at 4 °C. For double or triple IF, the corresponding antibodies were added simultaneously and incubated overnight at 4 °C. Sections were then washed with 0.1% Triton–PBS, incubated with the appropriate fluorochrome-conjugated secondary antibody, and nuclei were counter-stained with DAPI. After washing with PBS, sections were mounted with Prolong Gold Antifade Reagent (Life Technology).
For IHC analyses, after antigen retrieval, endogenous peroxidase was inactivated with 3% H 2 O 2 in methanol for 30 min at room temperature. Sections were incubated with 2% BSA-PBS for 1 h at room temperature, and then with the primary antibody overnight at 4 °C. After washing, the Envision secondary reagent (DAKO) was added for 40 min at room temperature and sections were washed x3 with PBS. 3,30-Diaminobenzidine tetrahydrochloride (DAB) was used as a chromogen. Sections were lightly counterstained with haematoxylin, dehydrated, and mounted. For some antibodies, an automated immunostaining platform was used (Ventana Discovery XT, Roche). A non-related IgG was used as a negative control. To validate the specificity of anti-NFIC antibodies, Nfic-/- pancreata were used as controls (Supplementary Fig. 1).
For CD45 quantification, whole digital slide images were acquired with an Axio Scan Z1, Zeiss scanner and then captured with the Zen Software (Zeiss). Image analysis and quantification were performed with the AxioVision software package (Zeiss). Briefly, areas of interest (AOI) were selected for quantification and then exported as individual TIFF images. CD45 staining were quantified using AxioVision 4.6 (Zeiss). Data obtained were then compiled and appropriately assessed. Images containing lymph nodes, and with artifactual staining or suboptimal cutting were eliminated from the analysis.
For quantification of KI67+ positive cells, at least 10 random images from each pancreas were selected and only positive acinar cells were quantified. For BIP quantification, at least 10 random images from each pancreas were taken and fluorescence intensity was calculated using FIJI software (https://fiji.sc/). For semi-quantitative analysis of KRT19 staining, intensity was scored from 0 to 3 by IC. A list of the antibodies used for IHC and IF is provided in Supplementary Table 1.
Quantitative RT-PCR (RT-qPCR)
For RNA isolation, pancreata were homogenized in denaturing buffer (4 M guanidine thiocyanate, 0.1 M Trizma HCl pH 7.5, 1% 2-mercaptoethanol) and processed as described earlier26. Total RNA was treated with DNase I (Ambion) for 30 min at 37 °C and cDNAs were prepared according to the manufacturer’s specifications, using the TaqMan reverse transcription reagents (Applied Biosystems, Roche). RT-qPCR analysis was performed using the SYBR Green PCR master mix and an ABIPRISM 7900HT instrument (Applied Biosystems). Expression levels were normalized to endogenous Hprt mRNA levels using the ΔΔC t method. Minor modifications of the above method were used to assess rRNA maturation, including the use of Gapdh mRNA for normalization The results shown are representative of at least three biological replicates. The sequence of the primers used is provided in Supplementary Table 2.
Immunoprecipitation and western blotting
Pancreata were snap-frozen for protein isolation. For immunoprecipitation of proteins from fresh total pancreas lysates, a piece of mouse pancreas was isolated and minced in 50 mM Tris-HCl pH 8, 150 mM NaCl, 5 mM EDTA, 0.5% NP-40 containing 3× phosphatase inhibitor cocktail (Sigma-Aldrich) and 3× EDTA-free complete protease inhibitor cocktail (Roche). Lysates were briefly sonicated until the protein solution was clear, cleared for 10 min at 12850 g at 4 °C and the supernatant was recovered. Antibody-coated protein A or protein G dynabeads (Life Technology) were used for immunoprecipitation. In brief, beads were washed three times with PBS and incubated with anti-NR5A2 or normal goat IgG (Millipore) overnight at 4 °C. After washing three times with PBS and twice with coupling buffer (27.3 mM sodium tetraborate, 72.7 mM boric acid), the dry beads were incubated overnight at 4 °C in freshly prepared 38 mM dimethyl pimelimidate dihydrochloride in 0.1 M sodium tetraborate. Afterwards, beads were washed three times with coupling buffer and once with 1 M Tris pH 9. Then, 1 ml of the Tris solution was added to the beads and incubated for 10 min at room temperature with rotation to block amino groups and stop crosslinking. Finally, beads were washed three times with storage buffer (6.5 mM sodium tetraborate/boric acid) and stored at 4 °C until used. Protein lysates (10-15 mg, tissues) were then incubated overnight at 4 °C with antibody-coated dynabeads (Thermo Fisher Scientific). Bound immune complexes were washed twice with lysis buffer containing NP-40, and then eluted by boiling in 2× Laemmli buffer (10% glycerol, 2% sodium dodecyl sulfate and 0.125 M Tris-HCl pH 6.8) for 5 min.
For western blotting, proteins were extracted from pancreatic tissue, isolated acinar cells or cultured cells using either Laemmli buffer, lysis buffer (50 mM Tris-HCl pH 8, 150 mM NaCl, 5 mM EDTA and 0.5% NP-40) or 5 M urea, supplemented with protease inhibitor and phosphatase inhibitor cocktails. Protein concentration was measured using the BCA reagent (Biorad), Nanodrop or extrapolated when using Laemmli lysis buffer. Proteins were resolved either by standard SDS-PAGE or 4-20% TGX pre-cast gels (Biorad) and transferred onto nitrocellulose membranes. A list of antibodies used for WB, ChIP and IP is provided in Supplementary Table 1. Densitometry analysis of digitalized western blotting images was performed using Fiji software (https://fiji.sc/).
Chromatin immunoprecipitation (ChIP)
Pancreas tissue was minced, washed with cold PBS supplemented with 3× protease and phosphatase cocktail inhibitors, and then fixed with 1% formaldehyde for 20 min at room temperature. Glycine was added to a final concentration of 0.125 M for 5 min at room temperature. The fixed tissue was soaked in SDS buffer (50 mM Tris pH 8.1, 100 mM NaCl, 5 mM EDTA and 0.5% SDS) and homogenized using a douncer. The supernatant was collected after centrifugation and chromatin was sonicated with a Covaris instrument for 40 min (20% duty cycle; 10% intensity; 200 cycle), yielding DNA fragments with a bulk size of 300–500 bp. Samples were centrifuged to pellet cell debris. The amount of chromatin isolated was quantified using Nanodrop; an aliquot of this material was used as input for final quantification. Samples (0.5-1 mg of chromatin) were diluted with Triton buffer (100 mM Tris pH 8.6, 0.3% SDS, 1.7% Triton X-100 and 5 mM EDTA) to 1 ml and pre-cleared for 2 h with a mix of protein A and G (previously blocked with 5% BSA) at 4 °C. Antibody-coated beads were added: anti-NR5A2 (2 μg), anti-NFIC (1 μg), and rabbit anti-PTF1A serum (1/500). Non-related IgG was used as a control. After incubating for 3 h at 4 °C in a rotating platform, beads were successively washed with 1 ml of mixed micelle buffer (20 mM Tris pH 8.1, 150 mM NaCl, 5 mM EDTA, 5% w/v sucrose, 1% Triton X-100 and 0.2% SDS), buffer 500 (50 mM HEPES at pH 7.5, 0.1% w/v deoxycholic acid, 1% Triton X-100, 500 mM NaCl and 1 mM EDTA), LiCl detergent wash buffer (10 mM Tris at pH 8.0, 0.5% deoxycholic acid, 0.5% NP-40, 250 mM LiCl and 1 mM EDTA) and TE (pH 7.5), and then bound molecules were eluted by incubating overnight in elution buffer (containing 1% SDS and 100 mM NaHCO 3 ) at 65 °C, and treated with proteinase K solution (10 M EDTA, 40 mM Tris-HCl pH 6.5, 40 μg/ml proteinase K). The eluted DNA was purified by phenol–chloroform extraction. After isolation, pelleted DNA was resuspended in nuclease-free water (150 μl). Gene occupancy was then analysed by real-time PCR using 1 μl of the eluted DNA diluted in a final volume of 10 μl. The sequence of the primers used for ChIP-qPCR is provided in Supplementary Table 3.
Nfic knockdown
NFIC expression was interfered in 266-6 cells using Mission shRNA lentiviral constructs purchased from Sigma-Aldrich. Nfic sh1 (TRCN0000374154 targeting ACAGACAGCCTCCACCTACTT), Nfic sh2 (TRCN0000310992 targeting TGTGTGCAGCCGCACCATATT), and Nfic sh3 (TRCN0000301779, targeting GATGGACAAATCTCCATTCAA). Control cells were transformed using lentiviral particles transducing the scrambled vector CCGGCAACAAGATGA AGAGCACCAACTCGAGTTGGTGCTCTTCATCTTGTTGTTTTT (shNT).
To produce lentiviral particles, HEK293-FT cells were allowed to reach 50% of confluence and transfected with 15 μg of shNT, Nfic sh1, Nfic sh2 or Nfic sh3 plasmids together with 8 μg of psPAX and 2 μg of pCMV-VSVG helper plasmids using CaCl 2 2 M HBSS. After 12 h, the supernatant was collected and replaced with 5 ml of fresh medium. The supernatant was collected 24 h, 48 h and 72 h after transfection. The medium was filtered (0.45 μm pore) and added to 266-6 cells (at 50–60% of confluence); 1 µg/mL of Polybrene (hexadimethrine bromide, Sigma-Aldrich 107689) was added to increase infection efficiency. After 2–3 rounds of infection, the supernatant was removed and replaced with fresh medium. One day later, puromycin (1–2 μg/ml) (Sigma-Aldrich) was added and 2 days later, the medium was replaced.
NFIC lentiviral overexpression
Nfic-HA tagged cDNA was purchased from Addgene (https://www.addgene.org/31403/) and subcloned into the lentiviral vector pLVX-puro using XhoI and XbaI. Insert sequence was checked using enzymatic digestion and Sanger sequencing. The production of lentiviral particles and cellular infection were performed as described earlier. The medium from the transfectants was collected 24 h, 48 h and 72 h after transfection. Subsequently, 266-6 cells were infected using Polybrene as described earlier. After selection with puromycin for 24–48 h, resistant 266-6 cells were collected for RNA and protein analysis.
Tunicamycin (TM) treatment
266-6 cells were seeded until they reached 70% confluence. After pilot dose-response experiments, a concentration of 10 nM was chosen; cells treated with TM or vehicle were collected at various time-points for RNA and protein analysis.
RNA-Seq library preparation and analysis
RNA from wild type and Nfic-/- pancreata was isolated as described above. Average sample RNA Integrity Number was 8.4 (range 7.8–9.2), assayed on an Agilent 2100 Bioanalyzer. PolyA+ fraction was purified and randomly fragmented, converted to double stranded cDNA, and processed through subsequent enzymatic treatments of end-repair, dA-tailing, and ligation to adapters as in Illumina’s “TruSeq Stranded mRNA Sample Preparation Part # 15031047 Rev. D” kit. Adapter-ligated library was completed by PCR with Illumina PE primers. The resulting purified cDNA library was applied to an Illumina flow cell for cluster generation and sequenced on an Illumina HiSeq2500 instrument by following manufacturer’s protocols. Image analysis, per-cycle base calling and quality score assignment was performed with Illumina Real Time Analysis software. Conversion of Illumina BCL files to bam format was performed with the Illumina2bam tool (Wellcome Trust Sanger Institute—NPG). FASTQ sequencing files were mapped to the mm10 using STAR with default parameters. Quantification of raw transcripts counts and Transcripts Per kilobase Million (TPM) was performed using the analyzeRepeats.pl of HOMER. Differential expression analysis was produced using getDiffExpression.pl tool of HOMER54. Pathway analyses of differentially expressed genes were performed using Metascape55 or molecular signature dataset of GSEA. The data containing the raw counts and TPM values for the genes in the downstream analyses, as well as the differentially expressed genes can be found in GEO (GSE126907). The Pearson correlation among samples was calculated from the expression value (expressed as fragments per kilobase of transcript per million mapped reads) of each gene for each sample by using the ‘cor’ command in R (https://www.r-project.org/). Principal component analysis was performed using the ‘prcomp’ command in R, from the correlation value of each sample.
RNA-seq data for Nr5a2 (GSE34030), Mist1 (GSE86288) mutant pancreata were downloaded from SRA. RNA-Seq of pancreata from wild type mice during pancreatitis was analysed as previously described26 and is available under GSE84659.
Comparison of gene expression in normal human pancreata according to NFIC transcript levels was performed using RNA-Seq data from GTEX website (https://gtexportal.org/home/datasets, version 6) (n = 171)56.The expression data matrix was sorted by NFIC expression levels taking the 10 individuals scoring highest and lowest NFIC expression levels (NFIChigh, NFIClow). Differential expression analysis using the DEGseq package of R (https://bioconductor.org/packages/release/bioc/html/DEGseq.html). MA-plot-based method with Random Sampling model -MARS56 was applied and only genes with significance P < 0.001 were used in the analysis.
Gene Set Enrichment Analysis (GSEA)
A ranking metric [−log10(p-value)/sign(log2FoldChange)] was used to generate a ranked gene list from the DEseq output. The list of pre-ranked genes was then analysed with using the molecular signature dataset of GSEA for Gene Ontology (GO), KEGG, REACTOME, HALLMARKS or CANONICAL PATHWAYS databases as described in the Figure legends and the text. Significantly enriched terms were identified using a false discovery rate (FDR) q-value of <0.25.
NFIC ChIP-Seq and data processing
Chromatin from mouse pancreas tissue was extracted and processed as described above. For ChIP sequencing, libraries were prepared from purified DNA using “NEBNext Ultra II DNA Library Prep Kit for Illumina” from New England BioLabs (NEB, #E7645), as per the manufacturers’ instructions. The resulting libraries were sequenced on Illumina HiSeq 2500, v4 Chemistry.
Data from NR5A2 ChIP-Seq in adult pancreata (SRR389293, SRR389294), NR5A2 ChIP-Seq in ES cells (GSM470523, GSM470524), PTF1A ChIP-Seq in adult pancreata (GSM2051452, GSM2051453), and MIST1 ChIP-Seq in adult pancreata (GSM2299654,GSM2299654, GSM2299655) were downloaded from the Gene Expression Omnibus website (https://www.ncbi.nlm.nih.gov/geo/) and analysis was performed as described26. Briefly, after the quality check by fastqc (v.0.9.4, Babraham Bioinformatics), the alignment and peak calling for the ChIP-seq data was performed using RUbioSeq+ pipeline57. Merging of replicate peaks and peak annotation was done using HOMER. Peak calling, annotation and motif enrichment was identified using HOMER (http://homer.ucsd.edu/homer/)54. Reads were directionally extended to 300 bp and, for each base pair in the genome, the number of overlapping sequence reads was determined and averaged over a 10-bp window to create a wig file to visualize the data in the University of California Santa Cruz (UCSC) genome browser.
NFIC ChIP-Seq data using GM12878, ECC1, HepG2, SK-N-SH and K562 cells were downloaded from (https://www.encodeproject.org/targets/NFIC-human/). ChIP-Seq peaks were analysed using Peak Analyser_1.4, using and Nearest Transcription Start Site parameter was used to annotate the genomic location of peaks. More than 95% of the target genes identified in the replicate with lowest number of target genes were included in the replicate with highest number. Among the two replicates, the one with highest number of identified target genes was taken: replicate 1 of NFIC ChIP-Seq in GM12878, NFIC ChIP-Seq in HepG2 and NFIC ChIP-Seq in SK-N-SH and replicate 2 of NFIC ChIP-Seq in ECC1 cell line.
Other statistical analyses
Comparisons of quantitative data between groups was performed using one-sided Mann–Whitney U-test in all cases for which there was a prior hypothesis. For comparisons showing a normal distribution of data, two-tailed Student’s t-test was used to calculate statistical significance. For comparison not showing a normal distribution, two-tailed Mann–Whitney U-test was used to calculate statistical significance. All group data are represented by the mean and errors bars are the standard deviation (SD). When comparing different groups within different variables, multiple comparison two-way ANOVA were used. Box plots represent the median and second and third quartiles (interquartile range, IQR) of the data. Error bars are generated by R software and represent the highest and lowest data within 1.5× IQR range. All statistical analyses were performed with Excel, R software, https://ccb-compute2.cs.uni-saarland.de/wtest/ or https://www.medcalc.org/calc/comparison_of_proportions.php. The random list of genes were generated using https://www.dcode.fr/random-selection and http://www.molbiotools.com/randomgenesetgenerator.html websites. Duplicated transcripts in RNA-Seq data were deleted for analysis. Dotted line refer to threshold for statistical significance (−log10[0.25] = 0.60) or (−log10[0.05] = 1.30). The statistical test used in each experiment is provided in the Figure legends or in the Source Data file.
Reporting summary
Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.