Further information and requests for resources and reagents should be directed to and will be fulfilled by the lead contact, Carl Feng ( [email protected] ).
For diet swapping experiments, mice were first fed on their condition diet (chow or AIN93G) for 3w and then switched to the alternative diet at either day 0 or day 7 p.i.. Some mice were maintained on chow and AIN93G throughout the studies as controls.
Irradiated chow diet (Meat Free Rat and Mouse Diet) and a AIN93G diet supplemented with extra vitamins (SF09-091) were purchased from Speciality Feeds (Glen Forrest, Western Australia). Unless specified, mice were pre-conditioned with chow or AIN93G diet for 3w before exposing to influenza virus.
Mice were maintained under specific pathogen-free conditions at University of Sydney Charles Perkins Centre and Centenary Institute with the ethics approvals from the University of Sydney (protocol 2019-066) and Sydney Local Health District (2015-037 and 2020-007), respectively. Wild-type (WT) C57BL6 mice were purchased from Australian BioResources (Moss Vale, NSW, Australia). Ifngr1 −/− mice on C57BL/6 background were bred in the Centenary Institute. Female animals aged between 6 and 20 wk old were used for all experiments. Mice were provided food and water ad libitum and housed in a temperature and humidity-controlled environment with a 12-hour light and 12-hour dark cycle.
Method details
Influenza A virus infection and mouse monitoring 58 Randhawa M.A. Calculation of LD50 values from the method of miller and tainter, 1944. After anaesthetizing with ketamine and xylazine, mice were inoculated intranasally with 2.5 or 5 PFU of mouse-adapted influenza A virus (strain A/Puerto Rico/8/1934 H1N1, kindly provided by Dr John Stambas) in 40 μL of sterile PBS. For the majority of metabolic and immunological analysis experiments, a lower inoculant dose 2.5 PFU was used. Viral dose required for 50% of the lethality (LD50) was calculated as previously described method.Mice were scored and monitored daily for food intake, body weight and temperature throughout the course of the study. Food consumption per cage was monitored by weighing food in the hopper. Body temperature of individual animals were recorded using a rectal thermometer.
Generation of bone marrow chimeric mice Lethally irradiated (10 Gy) naïve WT C57BL6 and Ifngr1−/− recipient mice were reconstituted with 2 × 106 bone marrow cells from Ifngr1−/− or C57BL6 mice by tail vein injection. Mice were maintained on antibiotic (Trimethoprim sulpha)-supplemented drinking water for 4 wk after irradiation. Mice were used for infection experiments after at least 8 wk when the recipient mice were fully reconstituted.
Treatments in mice For nitric oxide inhibition in vivo, L-NMMA (Cayman Chemical) was administered i.p. daily (2 mg/kg in PBS) until mice recovered or reached their humane endpoint. T3 (3,3′5-Triiodo-L-thyronine) (Cayman Chemical) treatment was initiated 7 days before IAV infection and continued throughout the duration of the study. T3 (100 μg/kg in PBS) was administrated daily by i.p. injection.
Promethion cage study and EchoMRI Mice were individually housed in Promethion behavioral phenotyping and respirometry cages (Sable Systems) with ad libitum access to food and water. Data on food and water consumption, distance travelled on the cage floor, VO 2 and VCO 2 were captured in real time via sensors and stored using the MetaScreen software (Sable Systems). Energy expenditure was determined by analyzing oxygen consumed and carbon dioxide exhaled and was corrected for lean mass. Respiratory quotient (RQ) was calculated based the ratio of oxygen consumed to carbon dioxide exhaled to determine the main fuel being used. For instance, RQ of 1 indicates carbohydrate usage as glucose uses six molecules of oxygen to generate six molecules of carbon dioxide. Food intake and water intake was measured in real time via sensors mounted in the food and liquid hoppers. Physical activity was measured by number of beam breakers in X, Y and Z axes. All data was analyzed in Rstudio, where relevant data were averaged over 12 hours to obtain day and night cycles as well as 24 hours to obtain daily measurements. Mouse lean and fat mass were determined using the EchoMRI-900 (EchoMRI LCC) in a non-invasive manner. Mice were awake and un-anesthetized during all measurements. Measurements were taken before as well as after infection (day 9).
Oral glucose tolerance, insulin tolerance and pyruvate tolerance test For glucose (GTT) and pyruvate (PTT) tolerance tests, mice fasted overnight were gavaged with a 30% glucose solution (1.5 g/kg body weight) and injected i.p. with pyruvate sodium solution (1 g/kg, Sigma Aldrich), respectively. For insulin tolerance test (ITT) mice were fasted for 4 hours and then injected i.p. with 0.75 U/kg of human fast working insulin (Actrapid). In all tests, blood glucose measurements were recorded at 0, 15, 30, 60 and 120 minutes using a glucometer (Libre).
Preparation of single cell suspensions from lung 59 Stifter S.A.
Bhattacharyya N.
Sawyer A.J.
Cootes T.A.
Stambas J.
Doyle S.E.
Feigenbaum L.
Paul W.E.
Britton W.J.
Sher A.
Feng C.G. Visualizing the selectivity and dynamics of interferon signaling in vivo. , 60 Bhattacharyya N.D.
Counoupas C.
Daniel L.
Zhang G.
Cook S.J.
Cootes T.A.
Stifter S.A.
Bowen D.G.
Triccas J.A.
Bertolino P.
et al. TCR affinity controls the dynamics but not the functional specification of the antimycobacterial CD4. 60 Bhattacharyya N.D.
Counoupas C.
Daniel L.
Zhang G.
Cook S.J.
Cootes T.A.
Stifter S.A.
Bowen D.G.
Triccas J.A.
Bertolino P.
et al. TCR affinity controls the dynamics but not the functional specification of the antimycobacterial CD4. Lung single cell suspensions were prepared using methods previously described.Briefly, lungs were incubated with 2 mg/mL of DNase I (Sigma Aldrich) and Collagenase IV (Sigma Aldrich) for 30 minutes. Lungs were dissociated and red blood cells were lysed using ACK lysis buffer (Thermo Fisher Scientific). Liver single cell suspensions were prepared using methods previously described.Briefly, liver leukocytes were enriched using 35% isotonic Percoll (Cytiva, Marlborough). For adipose tissue single cell suspensions, BAT and epididymal WAT were collected in 5 mL of PBS and minced with scissors. Minced epididymal white adipose tissue and brown adipose tissue were digested in a 37°C water bath using 2 mg/mL of Collagenase II (Sigma Aldrich) for 25 minutes and 40 minutes, respectively. Digested tissues were filtered through a 100 μm strainer and centrifuged at 500 g for 10 minutes. Supernatant was discarded and stromal vascular fraction (SVF) was resuspended in ACK lysis buffer. All single cell suspensions were washed with RPMI 1640 supplemented with 2% fetal calf serum (FCS) prior to being counted using trypan blue exclusion on a haemocytometer.
Flow cytometry Cells (1 × 106) were washed with FACS wash (PBS supplemented with 2% FCS and 2mM EDTA) prior to being stained with PA-H2Db+ conjugated to PE (NIH Tetramer Core Facility, Atlanta, GA, USA) for 1 hour at 4°C in FACS wash. After tetramer staining, cells were further stained with a surface receptor antibody cocktail containing FcBlock (2.4G2, BD Bioscience) and LIVE/DEAD fixable blue dead cell stain in FACS wash (Thermo Fisher Scientific) for 30 minutes at 4°C. For surface staining, cells were incubated for 30 minutes at 4°C with the following monoclonal antibodies: CD4 (RM4-5), CD8 (53-6.7) and CD44 (IM7). For intracellular staining of cytokines, cells were stimulated with 1 μg/mL of anti-CD3ε mAb (clone 145-2C11, BD Bioscience) in RPMI 1640 supplemented with 10% FCS containing 1:1000 Golgi-plug (BD Biosciences) for 5 hours at 37°C. Following surface staining, the cells were fixed with 100 μL of Cytofix/Cytoperm (BD Bioscience) for 20 minutes at 4°C. Cells were incubated in 1x Permeabilization buffer for 1 hour at 4°C containing a cocktail of the following monoclonal antibodies: IFN-γ (XMG1.2) and TNF-α (MP6-XT22). Cells were washed in 1x Permeabilization buffer and resuspended in FACS wash buffer prior to acquisition. All flow cytometry acquisition was performed on BD Fortessa using FACSDiva software (BD Biosciences) and all analysis was performed using FlowJo10 (TreeStar).
Histological analysis Paraffin-embedded brown adipose tissue collected from infected chow- and AIN93G-fed mice was sectioned at 5 μM and stained with hematoxylin and eosin (H&E). Slides were imaged by Leica Aperio XT slide scanner (Leica Biosystems) at x40 magnification and imported into ImageScope (Leica Biosystems). Individual fields (400 × 300 μM) randomly selected from the scanned images were analyzed using QuPath (Queen’s University, Belfast, Northern Ireland) or ImageJ (the National Institutes of Health, USA). Number of nuclei was determined in QuPath using the positive cell detection function. Lipid droplet diameter was determined in ImageJ by manual quantification and data points were imported into RStudio for graphic generation.
Cytokine quantification in plasma For plasma samples, blood in EDTA-coated tubes was centrifuged at 2000 g for 15 minutes and plasma collected. The cytokine (IFN-α, IFN-β and IFN-γ) concentrations in plasma were quantified using the LEGENDplex kit (BioLegend). All kits were used according to the manufacturer’s instructions.
Viral plaque assays MDCK cells (4.5 × 105/well) were seeded into 6-well culture plates. Plates were incubated for 24 hours at 37°C, 5% CO 2 . Lung lobes from infected mice were homogenized in PBS and centrifuged for 5 minutes at 2000 g to remove debris. Serially diluted lung homogenates in RPMI 1640 were added to the MDCK cells in 6-well culture plate (150 μL/well) and incubated at 37°C for 45 mins. The cells in each well were then overlaid with 3mL of L15 media (Sigma Aldrich) containing 1% (w/v) of Avicel (FMC biopolymer) and 1 μg/mL of trypsin (Worthington Biochemicals). After further incubation at 37°C, 5% CO 2 for 3 days, the cells were washed with PBS, fixed with methanol and stained with crystal violet for visualization. Plaque forming units (PFU) was calculated as per lobe.
RNA preparation and qRT-PCR Organs were preserved in RNAlater (Sigma Aldrich) and stored at −80°C. RNA extraction was performed using Trisure (Bioline) according to the manufacturer’s instructions and RNA quantity determined using a NanoDrop (2000c, Thermo Fisher Scientific). Purified RNA was reversely transcribed using the Tetro cDNA synthesis Kit with random primers (Bioline). Relative mRNA expression level was determined using the 2(-ΔΔC(T)) method and 18S as the reference gene. All quantitative reverse-transcriptase (qRT-PCR) was performed using SYBR NoROX master mix (Bioline) on a Roche LightCycler480. Primer sequences for each gene are described in Table S3 59 Stifter S.A.
Bhattacharyya N.
Sawyer A.J.
Cootes T.A.
Stambas J.
Doyle S.E.
Feigenbaum L.
Paul W.E.
Britton W.J.
Sher A.
Feng C.G. Visualizing the selectivity and dynamics of interferon signaling in vivo. 7 IAV (PR8) and transcribed using viral nucleoprotein specific primers (IAV NP – forward CAGCCTAATCAGACCAAATG; IAV NP – reverse TACCTGCTTCTCAGTTCAAG). The cDNA product was subsequently purified and total copy number was determined based on size and yield of the product. To determine viral nucleoprotein (NP) mRNA copy number, absolute viral NP quantification was performed as described.Briefly, RNA was extracted from 1 × 10IAV (PR8) and transcribed using viral nucleoprotein specific primers (IAV NP – forward CAGCCTAATCAGACCAAATG; IAV NP – reverse TACCTGCTTCTCAGTTCAAG). The cDNA product was subsequently purified and total copy number was determined based on size and yield of the product.