Human studies

These studies were approved by the Multi-regional Ethics Committee and Cambridge Local Research Ethics Committee (03/103, 03/104 and 18/EE/0032) and conducted in accordance with the principles of the Declaration of Helsinki. Each participant or their legal guardian (for children under 16 years of age) provided written, informed consent and minors provided verbal or written consent.

We studied people with severe obesity (BMI (kg m−2) SDS > 3) of early-onset (<10 years of age) recruited to the GOOS cohort (www.goos.org.uk) between 1997 and 2022. Referring physicians completed standardized questionnaires that captured medical history, family history and findings on clinical examination, including anthropometric data and the results of investigations. The sex of participants was assigned by clinical examination by physicians. To describe the prevalence of neurobehavioral conditions in the GOOS cohort, we excluded people in whom genetic obesity syndromes had been identified. As a result data on 7,775 people were included. Exome sequencing and targeted resequencing were performed in a subset of the cohort as previously described;12,13 all variants referred to in this study were verified by Sanger sequencing.

Probands and their families were invited to participate in physiological studies at the Wellcome-MRC Institute of Metabolic Science Translational Research Facility, Addenbrooke’s Hospital. Weight and height were measured barefoot in light clothing. Dual X-ray absorptiometry (DPX software; Lunar Corp) was used to determine body composition. BMR was determined by indirect calorimetry after a 10-h overnight fast using an open circuit, ventilated, canopy measurement system (Europa Gas Exchange Monitor; NutrEn Technology). BMR adjusted for body composition was compared to predicted metabolic rate based on standard age and sex-specific equations. Blood pressure was measured in the rested fasted state using wrist monitors (OMRON Healthcare). For the analysis of insulin and glucose, patients with type 2 diabetes were excluded. Blood samples were taken in the fasted state for all assays.

UK Biobank 200K OQFE exomes and clinical phenotypes

This research was conducted using the UK Biobank Resource22 under application no. 53821. We used pVCF variant file (chrX, block 17) from OQFE exome pipeline (UK Biobank Field 23156; n = 200,629 exomes available to us). Reported sex was obtained from Field 31 (Supplementary Table 2). We split and left-normalized multiallelic entries (bcftools v.1.9) and defined variant consequences with respect to Ensembl canonical transcript ENST00000276198 using Ensembl Variant Effect Predictor (Ensembl release v.102).

In females, we used genotype calls provided in the pVCF file. In males, we treated any non-homozygous-REF genotype as hemizygous, consistent with reported allelic depths. Relatedness was obtained from the UK Biobank (ukbgene rel) and one person was excluded from each related pair among all the OQFE exomes (kinship ≥ 0.0442, KING, third-degree kinship or closer; retained pairs contained within OQFE exomes and excluded individuals in column ‘ID2’; n = 15,547 people). Exomes were restricted European genetic ethnic grouping (Field 22006, self-reported ‘White British’ and tight cluster in genotype principal-component analysis). Unrelated European OQFE exomes were taken forward for analysis (n = 153,352).

We obtained BMI (kg m−2) from the UK Biobank initial assessment visit (Field 21001, Instance 0), available to us for n = 152,837 of 153,352 unrelated European exomes (83,864 females and 69,488 males). To investigate phenotypes related to anxiety or mood, we used the mental distress (‘Mental health problems ever diagnosed by a professional’, Field 20544) section of online follow-up Mental Health questionnaire (category 136) (rationale and design is provided at https://biobank.ctsu.ox.ac.uk/showcase/refer.cgi?id=22), which had an available ‘Date of completing’ (Field 20400) for n = 53,174 of 153,352 unrelated European exomes. Mental distress data provide self-reported professional diagnoses in 16 categories (https://biobank.ctsu.ox.ac.uk/showcase/field.cgi?id=20544); limitations include lack of complete data (returned questionnaires), ascertainment bias and self-reporting of professional diagnoses. Of 16 categories of mental distress, we selected three categories of interest: ‘psychological over-eating or binge-eating’, ‘anxiety, nerves or generalized anxiety disorder’ (anxiety) and ‘depression’, and for selected variants we further inspected the reporting of any category of mental distress in people who carried variants and those who did not.

Single-variant association analysis with BMI, obesity and severe obesity

Association analysis of single variants with allele count >20 was performed separately for females and males among unrelated European exomes (plink v.2.00a1LM; www.cog-genomics.org/plink/2.0/). Case–control association with severe obesity (BMI > 40 kg m−2) or obesity (BMI > 30 kg m−2) was performed using plink2 –glm with Firth regression; n = 2,725 individuals (1,868 females and 857 males) were severely obese; n = 36,304 individuals (19,018 females and 17,286 males) were obese. Association with BMI as a continuous trait was performed using plink2 –glm. Covariates were age (Field 21003) and 40 genetic principal components (Fields 22009.0.1–40). At very rare variants (allele count <20), ORs were calculated for the number of variant carriers using Fisher’s exact test.

Rare variant association tests

We performed gene-based association tests separately for males and females using non-synonymous exonic or splicing variants and severe obesity (BMI > 40 kg m−2), BMI > 30 kg m−2 and for continuous BMI. Gene-based burden and SKATO tests were performed using the SKATBinary_Robust function for dichotomized BMI or the SKAT function for continuous BMI, in R package SKAT v.2.0.1 (method = ‘Burden’ or ‘SKATO’ with default settings). Null models were calculated using SKAT_Null_Model(y~X) where covariates matrix (X) contained age (Field 21003.0.0), sex (Field 31.0.0), ten genetic principal components (Fields 22009.0.1–10) and sequencing batch (UKB 50K or 150K exomes). Single-variant P values reported from gene-based analyses are SKATBinary_Robust output values for p.value_singlevariant. ORs were also calculated for the number of variant carriers using Fisher’s exact test.

cDNA constructs and site-directed mutagenesis

The human WT HTR2C complementary DNA (Ensembl transcript ENST00000371951; unedited, INI isoform) was cloned into the pcDNA3.1(+) vector (Invitrogen) and a sequence encoding a FLAG tag was inserted downstream of the sequence encoding the receptor’s signal peptide using a Q5 site-directed mutagenesis kit (New England Biolabs). The edited VSV isoform was generated by changing adenosines at positions A, B, C and D to guanosines20, using the QuickChange II XL site-directed mutagenesis kit (Agilent). For β-arrestin protein–protein interaction assays, the receptor VSV isoform lacking a FLAG tag was cloned into the pBiT1.1-C (TK/LgBiT) vector and cDNAs encoding human β-arrestin-1 and -2 were ligated in pBiT2.1-N (TK/SmBiT) vectors (Promega) as described before49. Variant constructs of both backbones were generated using QuickChange II XL site-directed mutagenesis kit (Agilent). All constructs were verified using Sanger sequencing.

Cell culture and transfection

HEK293 or HEK293SL cells were maintained in high glucose Dulbecco’s modified eagle medium (Gibco, 31966), supplemented with 10% fetal bovine serum (Gibco, 10270, South America origin), 1% GlutaMAX (100×) (Gibco, 35050) and 100 U ml−1 penicillin and 100 μg ml−1 streptomycin (Sigma-Aldrich, P0781) and cultured at 37 °C in humidified air containing 5% CO 2 . Cells were transfected using Lipofectamine 2000 (Gibco, 11668) in serum-free Opti-MEM (Gibco, 31985) according to the manufacturer’s protocol.

Inositol triphosphate turnover assay

HEK293 cells were seeded in 96-well plates at a density of 40,000 cells per well and transiently transfected on the next day with 5 ng per well WT HTR2C or variant cDNA construct. After transfection, cells were cultured overnight in growth medium supplemented with 5 μl per well [3H]-myo-inositol (PerkinElmer, NET115600). Cells were washed once with Hank’s balanced salt solution (HBSS; Gibco, 14025) and subsequently stimulated with 20× 5-hydroxytryptamine stock solution (5-HT; Sigma-Aldrich, 85036) in HBSS containing 10 mM LiCl (Sigma-Aldrich, L9650) for 90 min at 37 °C. Cells were stimulated with different concentrations of 5-HT, ranging from 0 to 10−5 M. After aspirating the stimulation buffer, cells were lysed on ice for 30 min using 50 μl per well 10 mM formic acid (Sigma-Aldrich, F0507). Then 20 μl of lysate was transferred to a white 96-well plate containing 80 μl per well 12.5 mg ml−1 yttrium silicate poly-lysine-coated scintillation proximity beads (PerkinElmer, RPNQ0010) in ddH 2 O. Plates were sealed, shaken vigorously for 5 min and the relative amount of radiolabeled inositol monophosphate (IP 1 ) was quantified after 8 h of settle time using a TopCount 9012 Microplate Counter (Packard). Results were analyzed using GraphPad Prism 8 (GraphPad Software). Sigmoidal dose–response curves with variable slope (four-parameter logistic regression) were plotted. Results from each assay were normalized to mean counts from the bottom of the 5-HT 2C R WT curve set as basal and the top value of the 5-HT 2C R WT curve (maximal efficacy; E max ) as 100%. Cells transfected with pcDNA3.1(+) (mock) were used as a negative control. Normalized data for each experiment were merged and presented as sum curves, results are from 3–4 independent experiments.

β-arrestin protein–protein interaction assay

Coupling between 5-HT 2C R and β-arrestin-1 or β-arrestin-2 was quantified using the NanoBiT protein–protein interaction assay (Promega, M2014). Assays were performed in HEK293SL cells seeded in poly-d-lysine coated, white 96-well plates (15,000 cells per well) and transiently transfected with 50 ng per well of each of the two constructs as described above. As a negative control, the β-arrestin-SmBiT constructs were substituted with the HaloTag-SmBiT negative control vector. The day after transfection and half an hour before assay, culture medium was substituted for 70 μl per well serum-free Opti-MEM (Gibco, 31985). Nanoluciferase activity was measured at 37 °C and in the presence of 5% CO 2 using a Spark 10 M microplate reader (Tecan). After measurement of the background signal, 20 μl per well Nano-Glo Live Cell Assay System (Promega, N2013) was added and basal luciferase activity was measured for 10 min in 30-s intervals. Subsequently, cells were stimulated with 10 μl of 10 × 5-HT stock solution and the luminescent signal was quantified for 20 min in 30-s intervals. Dose–response curves (sigmoidal with variable slope) were plotted from total peak area under the curve values calculated from each 5-HT concentration, ranging from 0 to 10−5 M. Normalized data from independent experiments were merged and presented as sum curves. Results are from 4–5 independent experiments.

Cell surface expression ELISA

HEK293 cells seeded onto poly-d-lysine coated 96-well plates (40,000 cells per well) were transfected with 5 ng per well of FLAG-tagged HTR2C constructs as described above. The day after transfection, the cells were fixed with 3.7% paraformaldehyde in PBS for 15 min at room temperature and washed three times with PBS. Subsequently, nonspecific binding sites were blocked with 3% non-fat dry milk in 50 mM Tris-PBS pH 7.4 (blocking buffer) for 1 h at room temperature. Cells were incubated with a mouse monoclonal anti-FLAG antibody (Sigma-Aldrich, F1804), diluted 1,000× in blocking buffer overnight at 4 °C. Next, cells were washed three times with PBS and incubated with goat anti-mouse IgG (H + L)-HRP conjugate (Bio-Rad Laboratories, 172-1011) (1:1,250 dilution in 1.5% non-fat dry milk in 50 mM Tris-PBS) for 2 h at room temperature. Finally, cells were washed three times with PBS and the chromogenic substrate 3,3′,5,5′-tetramethylbenzidine (TMB CORE+, Bio-Rad Laboratories, BUF062) was used to detect HRP activity. The reaction was stopped with 0.5 M H 2 SO 4 and absorbance at 450 nm was quantified using a Tecan Infinite M1000 PRO microplate reader.

Radioligand binding assay

HEK293 cells were seeded in solid white 96-well plates coated with poly-d-lysine and transiently transfected with 50 ng per well FLAG-tagged HTR2C constructs. The day after transfection, cells were washed once and incubated on ice with binding buffer (50 μl per well; 20 mM HEPES pH 7.4, 118 mM NaCl, 4.7 mM KCl, 5 mM MgCl 2 , 5.5 mM d-glucose and 0.1% BSA) for 30 min. Next, varying doses of unlabeled 5-HT (0 M to 10−4 M) were added to the cells, immediately followed by 50 μl per well of the 3H-labeled 5-HT 2C R antagonist mesulergine (PerkinElmer, NET1148; 1:5,000 dilution in binding buffer) and cells were incubated on ice for 3 h. After washing twice with ice-cold binding buffer, 20 μl per well 0.1 M NaOH was dispensed and plates were shaken, followed by adding 80 μl per well MicroScint-20 scintillation fluid (PerkinElmer, 6013621). Plates were shaken and activity of bound 3H-mesulergine was quantified after a 3 h settle time, using a TopCount 9012 Microplate Counter (Packard).

Immunofluorescence

HEK293SL cells (10,000 cells per well) were seeded onto poly-d-lysine coated CellCarrier-96 Ultra plates (PerkinElmer, 6055302) and transfected on the following day with 40 ng per well FLAG-tagged constructs as described above. The next day, the cells were fixed with 3.7 % paraformaldehyde in PBS for 15 min and washed twice with PBS. Nonspecific antibody binding sites were blocked with blocking buffer (3 % BSA in PBS) for 1 h. The cells were then incubated with primary antibody (mouse monoclonal anti-FLAG; Sigma-Aldrich, F1804; 1:100 dilution in blocking buffer) for 1 h. After three washing steps with PBS, cells were incubated with secondary antibody (Alexa Fluor 488 goat anti-mouse IgG (H + L); Life Technologies A11029; 1:400 in blocking buffer) for 1 h in the dark. Plates were washed thrice with PBS and cells were permeabilized with 0.1 % Triton X-100 (VWR, 306324 N) in PBS for 5 min. In parallel experiments to capture intracellular receptors, cells were permeabilized before adding the primary anti-FLAG antibody together with an anti-calreticulin antibody, to visualize the ER (Invitrogen, PA3-900, 1:100 dilution), which was recognized using a Alexa Fluor 647 donkey anti-rabbit IgG (H + L) (Thermo Fisher Scientific, A-31573) at a 1:400 dilution in blocking buffer. Next, cell nuclei were stained with DAPI (Merck, D9542; 0.1 μg ml−1 final concentration in PBS) for 10 min, followed by three washing steps with PBS. Finally, cells were incubated with DyLight 554 Phalloidin (Cell Signaling Technology, 13054; 1:200 dilution in PBS) for 15 min to stain cytoskeletal F-actin. Cells were washed twice with PBS and stored in the dark at 4 °C before imaging on an Opera Phenix High-Content Screening System (PerkinElmer). For high-content analysis of WT and mutant protein levels at the cell surface and in the cytoplasm, the PerkinElmer Harmony software was used (HH17000012, version 5.0); the DyLight Phalloidin and DAPI channels were used to identify cells and the signal strength of the 488 nm channel was calculated per cell. For ER localization, the overlap between the calreticulin and the 488 nm channel was quantified. Each condition was performed in four technical replicates (on average 400 cells per well) and the mean intensity of all cells per well was calculated. Results shown are from three independent experiments.

Approval for studies in mice

Care of animals and procedures were approved by the Baylor College of Medicine Institutional Animal Care and Use Committee.

Generation of Htr2c F327L mice

The F327 amino acid residue in the human 5-HT 2C R protein is equivalent to the F328 of the mouse 5-HT 2C R protein. We generated a knock-in mouse with the F328L mutation but referred it as Htr2cF327L for simplicity. A single-guide RNA (sgRNA) sequence (5′-TTTCATCACCAATATCCTGT) was selected to target the mouse Htr2c gene encoding the F328 and the sgRNA was purchased from Synthego. Cas9 Nuclease was purchased from IDT (Alt-R S.p. Cas9 Nuclease V3). The donor ssDNA template to introduce the F328L point mutation and a silent mutation C326C to remove the restriction site for NlaIV were purchased from IDT. The sequence of ssDNA is as follows: 5′-AATGAGAAGAAAGCTTCCAAAGTCCTTGGCATTGTATTCTTTGTGTTTCTGA TCATGTGGTGTCCGCTTTTCATCACCAATATCCTGTCGGTGCTTTGTGGGAAGGCCTGTAACCAAAAGCTAATGGAGAAACTTCTCAATGTGTTTGTTTGGATT. The BCM Genetically Engineered Murine Model Core microinjected Cas9 (20 ng μl−1), ssDNA (20 ng µl−1) and sgRNA (20 ng μl−1) into the pronuclei of 139 one-cell stage C57BL/6J embryos. Founder animals (F 0 ) were identified by PCR-based restriction digestion to detect the CRISPR generated point mutations in the Htr2c gene. PCR product was amplified with the primer pairs: 5′-ACGTCGAAAGAAGAAAGAAAAGC and 5′-GGTAAATTTTGTTGAAGAGAGTGTAC. The 266-bp PCR products were then digested with NlaIV. After the digestion, 153, 79 and 34-bp fragments could be detected for PCR products from a WT allele; 232 and 34 bp fragments could be detected from a mutant Htr2cF327L allele. Three independent lines were sequenced for the further confirmation of the point mutation. One of these lines was crossed to C57BL/6J to produce study cohorts. In some breeding, the POMC-CreER/Rosa26-LSL-td TOMATO alleles were introduced to allow specific labeling of POMC neurons.

Food intake, body weight and body composition

Male and female WT and Htr2cF327L littermates were singly housed from 5 weeks of age. Mice were fed ad libitum with a regular chow diet (5V5R-Advanced Protocol PicoLab Select Rodent 50 IF/6F, PicoLab) from weaning to 18 weeks of age and then fed with a HFD (60% fat, no. D12492i, Research Diets) from 18 weeks to 27 weeks of age. Body weight and food intake were measured weekly. Fat mass and lean mass were determined by quantitative magnetic resonance at 18 weeks of age in male mice and at 27 weeks of age in both male and female mice.

Glucose and insulin tolerance tests

For glucose tolerance tests, after an overnight fast, mice received intraperitoneal (i.p.) injections of 1 g kg−1 d-glucose (G8270, Sigma) at 10:00. Blood glucose was measured from tail blood using a glucometer (OneTouchUltra) at 0, 15, 30, 60 and 120 min. For insulin tolerance tests, after a 4-h fast to empty the stomach, mice received i.p. injections of insulin (0.75 U kg−1). Blood glucose was measured at 0, 15, 30, 60 and 90 min.

TSE PhenoMaster metabolic cages

Male mice were acclimated into the TSE PhenoMaster system at 18 weeks (the end of chow feeding period) and again at 27 weeks (the end of HFD feeding period). Female mice were acclimated to the TSE PhenoMaster system at 27 weeks (the end of HFD feeding period). After acclimation for 2 d, food intake, O 2 consumption, CO 2 production, heat production, xy axis and z axis movements were continuously monitored for 4 d and data collected from the last 2 d were used for analysis. O 2 consumption, CO 2 production and heat production were analyzed using the online CalR tool50.

Lorcaserin-induced anorexia and c-fos expression in POMC neurons

Male WT and Htr2cF327L/Y mice (at 6 months old) and female WT and Htr2cF327L/+ mice (at 2 months old) were briefly fasted for 2 h (16:00 to 18:00). Then, these mice received i.p. injections of saline or lorcaserin (3 mg kg−1) at 18:00. Food was provided to the cages immediately after the injections and food intake was measured for 1 h. Three days later, these mice were subjected to the same protocol with lorcaserin or saline injections in a crossover fashion.

Male WT and Htr2cF327L/Y mice (at 7 months old) and female WT and Htr2cF327L/+ mice (at 4 months old) were briefly fasted for 2 h (14:00 to 16:00) to empty the stomach and then received i.p. injections of saline or lorcaserin (3 mg kg−1). One hour later, mice were anesthetized with inhaled isoflurane and quickly perfused with saline, followed by 10% formalin. The brain sections were cut at 25 µm and collected into five consecutive series. One series of brain sections were blocked with 3% normal donkey serum for 1 h incubated with rabbit anti-β-endorphin antibody (1:10,000 dilution; no. H-02233, Phoenix Peptide) and mouse anti-c-Fos antibody (1:1,000 dilution, Ab208942, Abcam) on shaker at room temperature for overnight, followed by the donkey anti-rabbit Alexa Fluor 488 (1:200 dilution, A21206, Invitrogen) and donkey anti-mouse Alexa Fluor 594 (1:200 dilution, A21203, Invitrogen) for 2 h. Slides were cover-slipped and analyzed using a fluorescence microscope. The numbers of β-endorphin-positive cells and c-Fos/β-endorphin double positive neurons in the arcuate nucleus of the hypothalamus were counted in all brain sections and the ratio of c-Fos/β-endorphin double positive neurons to β-endorphin-positive neurons was used to reflect the data value for that mouse. Three mice were included in each group for statistical analyses.

Leptin-induced anorexia

Male WT and Htr2cF327L/Y mice (at 6 months old) and female WT and Htr2cF327L/+ mice (at 2 months old) were briefly fasted for 2 h (16:00 to 18:00). Then, these mice received i.p. injections of saline or leptin (5 mg kg−1) at 18:00. Food was provided to the cages immediately after the injections and food intake was measured for 1 h. Three days later, these mice were subjected to the same protocol with leptin or saline injections in a crossover fashion.

Electrophysiology

Male POMC-CreER/Rosa26-LSL-tdTOMATO and POMC-CreER/Rosa26-LSL-td TOMATO/Htr2cF327L/Y littermates at 5–6 months old were used for recordings from POMC neurons in the ARH. Mice were anesthetized with isoflurane and were transcardially perfused with a modified ice-cold sucrose-based cutting solution (pH 7.4; containing 10 mM NaCl, 25 mM NaHCO 3 , 195 mM sucrose, 5 mM glucose, 2.5 mM KCl, 1.25 mM NaH 2 PO 4 , 2 mM sodium pyruvate, 0.5 mM CaCl 2 and 7 mM MgCl 2 , bubbled continuously with 95% O 2 and 5% CO 2 ). The mice were then decapitated and the entire brain was removed and immediately submerged in the cutting solution. Coronal slices (220 μm) were cut with a Microm HM 650V vibratome (Thermo Scientific). Brain slices containing the ARH were collected and recordings were made at levels throughout this brain region. The slices were recovered for ~ 30 min at 32 °C and then maintained at room temperature for another 1 h in oxygenated (95% O 2 and 5% CO 2 ) artificial cerebrospinal fluid (pH 7.4; containing 126 mM NaCl, 2.5 mM KCl, 2.4 mM CaCl 2 , 1.2 mM NaH 2 PO 4 , 1.2 mM MgCl 2 , 11.1 mM glucose and 21.4 mM NaHCO 3 ) before recording.

Slices were transferred to the recording chamber at 32 °C and perfused continuously with oxygenated artificial cerebrospinal fluid at a flow rate of 1.8–2.0 ml min−1. Slices were allowed to equilibrate for at least 5 min before recording. tdTOMATO-labeled neurons in the ARH were visualized using epifluorescence and infrared–differential interference contrast (IR–DIC) imaging on an upright microscope (Eclipse FN-1, Nikon) equipped with a moveable stage (MP-285, Sutter Instrument). Patch pipettes with resistances of 3–5 MΩω were filled with intracellular solution (pH 7.3) containing 128 mM potassium gluconate, 10 mM KCl, 10 mM HEPES, 0.1 mM EGTA, 2 mM MgCl 2 , 0.05 mM GTP (sodium salt) and 0.05 mM ATP (magnesium salt). Recordings were made using a MultiClamp 700B amplifier (Axon Instruments), filtered at 1 kHz and sampled at 10 kHz using Digidata 1440A and analyzed offline with pClamp v.10.3 software (Axon Instruments). Series resistance was monitored during the recording and the values were generally <10 MΩ and were not compensated. The liquid junction potential was monitored and corrected. Data were excluded if the series resistance exceeding 20% change during the experiment or without overshoot for action potential. Current clamp was engaged to test neural firing frequency and resting membrane potential at the baseline and after puff delivery of lorcaserin (5 s at 30 μM). To ensure that each recorded neuron receive same amount of lorcaserin, the neurons located on the surface of the slice were selected for recording and the puff pipette was always put at a 100 μm horizontal and 100 μm vertical distance from the recorded neurons. The puff strength was maintained at a same level using a repeatable pressure pulse system (Picospritzer III, Parker). Each neuron was recorded at least 1 min baseline and only the neurons with stable baseline were used to test the lorcaserin treatment. The values of resting membrane potential and firing frequency were averaged in baseline and in a 1-min range containing the point with the maximal change in resting membrane potential after lorcaserin puff. A neuron was considered activated if a change in membrane potential was at least 2 mV, whereas values between a 2 mV were defined as ‘non-responsive’. Clampfit v.10.6 was used to analyze electrophysiology data.

Resident-intruder test

We used the resident-intruder paradigm to measure social behaviors of male WT and Htr2cF327L/Y littermates (4–5 months old) or in female WT and Htr2cF327L/+ littermates (4 months old) in a semi-natural setting7. Mice were singly housed in the resident cage for at least 1 week before testing. The cage remained uncleaned and unchanged for 1 week before testing so that there were olfactory cues to enhance the resident mouse’s territoriality. We started the test by introducing an unfamiliar retired male breeder into the home cage in the afternoon and 7 min later, the intruder was removed from the home cage. All behaviors of mice were continuously recorded with a video camera during the 7-min period. The recorded videos were analyzed in a blinded fashion to measure the time spent by the resident mouse in various behaviors listed below: social exploration (nose–nose sniffing and anogenital sniffing), non-social exploration (self-grooming and cage exploration), defensive behaviors (move away from the intruder, flight and freeze) and offensive behaviors (lateral threat, upright position, clinch attack, keep down and chasing).

Three-chamber social interaction test

This test was used to evaluate social behavior in male WT and Htr2cF327L/Y littermates (4–5 months old) or in female WT and Htr2cF327L/+ littermates (4 months old). The social interaction test used a three-chambered box with openings between chambers for the mouse to pass through. The test had three sessions: habituation, sociability and social novelty. During the habituation, we put an empty pencil cup upside down into each of the side chambers and a test mouse was released into the center chamber and allowed to explore all the chambers for 15 min. After the habituation session, one novel object was put into the pencil cup on one side and a never-before-met intruder mouse (mouse 1) was placed under the cup on the other side. The sociability session took 15 min. A second never-before-met intruder mouse (mouse 2) was used during the social novelty session to swap out the novel object under the pencil cup. The test mouse again had 15 min to investigate each chamber. The time spent sniffing each pencil cup was recorded. During the sociability session, we calculated the ratio between time spent sniffing mouse 1 and total time spent sniffing mouse 1 or the object to reflect test mouse’s sociability; in the social novelty session, we calculated the ratio between time spent sniffing mouse 2 and total time spent sniffing mouse 1 or mouse 2 to reflect test mouse’s social novelty.

Risk assessment in the elevated plus-maze test

The EPM apparatus is a ‘+’ shaped maze made of plexi-glass. It consists of two open arms, two closed arms and a center area that are elevated above the floor. The test starts once the animal is placed into the center area. As the animal freely explores the whole maze areas, its behavior is recorded by a camera mounted above the maze. The test lasts for 6 min. After the test, videos were analyzed using Noldus EthoVision XT (v.14.0) or by one tester for different behaviors. The number of visits to open arms and the time spent in open arms were calculated. One tester was blind to the group information of each mouse and counted other behaviors in the videos. When a mouse stands at the center area deciding which arm to enter, the mouse will show a stretch-attend posture with head and shoulders stretching toward the open arms. This posture is defined at ‘risk assessment behavior’. The tester counted the number and the duration of risk assessment behavior in the boundary between the center area and the open arms. When the mouse explores the open arm, the mouse sometimes will show a head dipping posture standing at the side edge of the open arms with head and shoulders dipping down toward the floor. The number and duration of head dipping behavior was counted by the tester as an indication of fearless behavior.

Statistical analysis

All results were analyzed using GraphPad Prism 8 (GraphPad Software) to evaluate normal distribution and variations within and among groups. For inositol triphosphate turnover assays β-arrestin coupling assays, statistical significance of differences in E max and EC 50 between WT and variant receptors was determined using unpaired Student’s t-tests with Welch correction. For all animal studies, the minimal sample size was predetermined by the nature of experiments. For most of physiological readouts (such as body weight, food intake, energy expenditure and body composition), at least six different mice per group were included. For histology studies, the same experiment was repeated in at least three different mice. For electrophysiological studies, at least 30 different neurons from three different mice were included. The data are presented as mean ± s.e.m. or as individual data points. Methods of statistical analyses were chosen based on the design of each experiment and are indicated in figure legends. P < 0.05 was considered to be statistically significant.

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.